Molecular Biology 101: DNA testing


Today, archaeologists from the University of Leicester announced that they believe they have found the lost grave of the last English King of the house of York, Richard III. They have been testing bones believed to be his to compare his DNA with that of known descendants in order to confirm his identity. This is a pretty similar process to the DNA testing we hear about all the time for paternity tests, or forensic studies: but how does it actually work?

DNA testing is based on the premise that, while 99.9% of human DNA is the same, 0.1% differs: and the more closely two people are related by blood the smaller that number will be. A number of arbitrary motifs in the DNA (called DNA markers) are used to basically play spot the difference. The most commonly used type of DNA marker is a group called variable number tandem repeats (VNTR), which is fairly split into microsatellites (2-6bp) and minisatellites (usually 10-60bp).

A VNTR is basically a sequence that is repeated a set number of times, that differs between people.

So I might have a sequence that reads

GGCCACCACGGGCAGGCAGGCAGGCACCGCCAAG

and my friend might have a sequence that reads

GGCCACCACGGGCAGGCAGGCAGGCAGGCAGGCAGGCAGGCACCGCCAAG

Our DNA contains hundreds of these sequences, and by using visualisation techniques it is possible to compare them. The CODIS database (The FBI’s criminal database) uses 13 of these markers, mostly consisting of 4-nucleotide-repeats (like the ones above) to produce a unique DNA fingerprint.

gel electrophoresis

Because we have different numbers of repeats at each loci, we generate smaller and bigger fragments, that settle in different positions on the gel.

If you’re interested in the nitty gritty of how this actually works, first have a read of this explanation of PCR that I wrote. As you’ll see, essentially PCR uses two known sequences on either side of the area of interest, to amplify the bit in the middle. So if I looked at the repeating sequence above, I would amplify a smaller piece of DNA from me and a bigger piece from my friend. These sequences can be run out on an electrophoresis gel, or through a capillary system,  to separate them by charge (and therefore by size) and they will look different. By looking at 13 different loci (locations on the genome) we will have up to 52 different data points to look at (13 samples, with up to two alleles in each person).

 

So I guess the next question is, can we just use the normal criminal DNA testing system of Richard III and his family? Well, no. Every step away from another person in your family you get makes you slightly less related.

gel electrophoresis 2

Left to right, (hypothetical) changes from me to my great great great grand mother

Each change might look miniscule, but by the time we’ve gone back five generations I share no markers with my great great great grandmother, making it impossible to test for relatedness.

 

 

 

Luckily, there’s a solution: as every year 9 biologist knows, we inherit half of our DNA from our mothers, and half from our fathers, resulting in us having two copies of every gene. Except…. we don’t. Our DNA doesn’t just come neatly packaged in the nucleus of our cells. Other organelles (mitochondria and, in plants, chloroplasts) contain a little bit of DNA too, left over from the days when those organelles were free living bacteria. These are carried along in the cytoplasm of the sperm and eggs when they merge, and because the egg is over 500 times larger than the sperm it contributed many many more mitochondria.

This means there is a source of DNA that isn’t merged, or muddled. The only way it changes is by mutation. This maternal mitochondrial DNA is used for longer term inheritance studies, such as this Richard III test. Because it doesn’t undergo recombination during every round of meiosis (i.e. it doesn’t get shuffled in every generation) it is much more stable, and can be used to compare much more distantly related people. It’s a similar system to what is used to compare different species like chimps, humans and gorillas.

In order to confirm the identity of Richard III the sequence of known mitochondrial genes in descendants of the royal family will have been compared to the sequence of DNA extracted from the bones unearthed: and in this instance they were found to match. Bingo: identity confirmed – The king under the car park!

Advertisements

One response to “Molecular Biology 101: DNA testing

  1. Thanks for writing this! You explained it so clearly!

Leave a Reply

Fill in your details below or click an icon to log in:

WordPress.com Logo

You are commenting using your WordPress.com account. Log Out / Change )

Twitter picture

You are commenting using your Twitter account. Log Out / Change )

Facebook photo

You are commenting using your Facebook account. Log Out / Change )

Google+ photo

You are commenting using your Google+ account. Log Out / Change )

Connecting to %s